Nashville Warbler subspecies determined by DNA
Thanks to those who have commented on the Nashville Warbler DNA identification both privately and publicly. As Alan points out, until more research is conducted on the two Nashville subspecies, DNA identification may be the only way to definitively separate these taxa. There were indeed several of us who thought that this bird was a western Nashville (ridgwayi) but I put out the request for a feather knowing that it would never be documentable without further evidence.
It is good to now be able to state that it was almost certainly an eastern bird (I don't put much faith in the two bird theory but threw it out there as it is possible). This exercise has prompted interest in identifying another possible western Nashville vagrant and we will report on that if we are successful in obtaining sequence data.
Several people have asked how we went about doing the actual sequencing so I thought I would outline it briefly here for those who are interested. We are still quite far from a Star Trek tricorder for making these identifications but it can be done with a bit of effort using very little tissue (just a few breast feathers in our case).
First step is to extract genomic DNA using a kit. We then ordered primers and followed published cycling (PCR) conditions for two mitochondrial genes. PCR produces billions of exact copies of the target region of DNA. The target DNA is then cleaned up, tagged with fluorescent dyes (so each base pair is a different colour) and sequenced. Cost to hear is about 100 bucks. Once the primers are in the lab, it costs <40 bucks to do this. From here, anyone can do the analysis. I downloaded the cytochrome B data from GenBank, added our data, and ran the analysis on it (<
http://www.ncbi.nlm.nih.gov/nuccore/?term=txid125952[Organism:noexp]>
is the link to all of the nucleotide data on GenBank - you can download all published sequences for particular genes from this page).
I aligned our data using a free program called Mesquite and analyzed the data using PAUP* (the free program TNT would also do the job). For the COI gene data it is possible to follow the same procedure.
However, a much easier method is to use the BOLD ID engine to identify the specimen (go to <
http://www.boldsystems.org/index.php/IDS_OpenIdEngine> and paste in the sequence and it produces a tree based comparison of sequences along with your unknown sequence.
Here is the COI sequence of the Sedgewick Nashville Warbler if you want to try it yourself:
CTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTTATCCGAGCAGAACTAGGCCAACCCGGAGCCCTTCTGGGAGACGACCAAGTCTACAATGTAGTTGTCACGGCCCATGCCTTCGTAATAATTTTCTTTATAGTCATACCGATTATAATCGGAGGATTCGGAAACTGACTAGTTCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCACCATCATTCCTTCTTCTACTAGCATCCTCCACAGTTGAAGCAGGTGTAGGCACAGGTTGAACAGTGTACCCTCCACTAGCTGGCAACCTAGCCCACGCCGGAGCCTCAGTCGACCTTGCAATTTTCTCTCTACATCTAGCTGGTATTTCCTCAATCCTCGGGGCAATCAACTTCATTACAACAGCAATCAACATGAAACCTCCTGCCCTATCACAATACCAAACCCCACTATTCGTCTGATCAGTACTAATCACTGCAGTTCTCCTGCTCCTCTCCCTCCCAGTCCTAGCTGCAGGAATCACAATGCTCCTCACAGACCGCAACCTCAACACTACATTCTTTGACCCTGCCGGAGGAGGAGATCCCGTCCTATACCAACATCTATTCTGATTCTTCGGACACCCAGAAGTCTACATCCTAATCCTA
Go to <
http://www.boldsystems.org/index.php/IDS_OpenIdEngine>. Click the button "All barcode records on BOLD". Paste in this sequence.
Click Submit. It comes up with a table of closest matches. Click the button for tree based identification. Click View Tree. You should now see the unidentified Sedgewick warbler in red in the Vermivora ruficapilla clade. This is the eastern subspecies. Note that the Vermivora ruficapilla specimen in blue is the western subspecies. It is actually more closely related to Lucy's, Colima and Virginia's Warbler than to the eastern subspecies of Nashville according to this gene tree. The cytochrome B results show a similar relationship - the 2 Nashville Warbler species are not sister taxa. If one follows the phylogenetic species concept, data from these two genes clearly indicate that they should be treated as separate species. More work is clearly needed on these birds.
Good birding!
Jeff Skevington